learn-genomics-in-linux

An interactive course on learning genomics/bioinformatics tasks in Linux.

View on GitHub

Task1 - Learning the Linux shell

This task will introduce students to the Linux command-line (shell environment).

Requirements


What is the Linux Shell?

The shell is a command-line programming language for interacting with the UNIX operating system.

There are several different shell languages. What we will be using in this course is a popular shell flavor called BASH

We will be learning basic commands, but BASH is actually a language that can perform complex programming tasks.

Getting Started

Before you can begin with the coding exercises, you must have access to a linux machine. You can either use your own local system or a remote server that has been set up for you.

Accessing the remote server

You can access the remote server through a terminal (full instructions on LEARN) like this:

ssh yourUserName@genomics1.private.uwaterloo.ca

When you are done, you can leave your session by typing…

exit

Once you are logged on | Learning the command-line

If you have logged in correctly, you should see a welcome screen.

You are now in a unix command-line environment. For more information and instructions:

A Linux Shell primer

When you log in, by default you start in your home directory.

Type…

pwd

And this will print to the screen your current location (e.g., /home/username)

You can always get back to your home folder by typing

cd

To view the contents of your current folder type

ls

To make the folder “task1”, type

mkdir task1

Change directory into ‘task1’ folder

cd task1

And now create a file called file.txt

>file.txt

Open the file with nano. This is one built-in text editor. There are others.

nano file.txt

Now enter a few lines of text, type ‘ctrl-o’ and then ‘ctrl-x’ to save and exit

To print to the screen the contents of your file

cat file.txt

Other ways of viewing your file

less file.txt  #type q to exit
more file.txt
head file.txt
head -n 10 file.txt # first 10 lines of your file
tail file.txt
tail -n 10 file.txt # last 10 lines of your file

Size of your file

du file.txt
du -h file.txt # in human-readable output (byte, kb, mb, etc.)

To count the number of words and lines in your file

wc file.txt #words
wc -l file.txt #lines
wc -m file.txt #characters

To copy the file to a new file

cp file.txt newfile.txt

You can also ‘move’ a file to a new location or rename it using mv.

To combine both files together into a third file

cat file.txt newfile.txt > thirdfile.txt

The ‘>’ redirects the output of the commands on the left of it to a file specified on the right.

Delete the file (note: be careful since there is no Trash Bin)

rm file.txt

Print contents of all .txt files in current folder. * acts as a wildcard

cat *.txt

Delete all .txt files in the current folder

rm *.txt

Delete all files in the current folder

rm *

Move back to the previous folder

cd ..

And delete the folder ‘task1’

rmdir task1

Getting help on linux commands and program usage

For most commands, you can get more information on their usage by typing man ‘command’.

e.g., try

man ls
#type 'q' to quit
#Note: this line and the line above are interpreted as comments since they start with the "#" character. They will not be executed as a command.

man will work with some bioinformatics tools. However, not always.

e.g., for help on the blastp tool, type

blastp -h # or
blastp --help

Additional operations

Pattern finding with grep

grep "word" file.txt  # prints lines in file.txt containing "word"

grep -o "word" file.txt #print out all the occurrences of "word"

grep -c "word" file.txt # counts the number of lines containing "word" in file.txt

Note: Be careful when using grep to analyze files containing nucleic acid or protein sequence data.

e.g., your FASTA file may be separated into multiple lines like this:

>myFastaSequence
ATCGACGTTATCGACTAGCTAT
TCGGCGCGGTATTAGCGATTCG
TAATATCGGCGCGATATATCGA

instead of this:

>myFastaSequence
ATCGACGTTATCGACTAGCTATTCGGCGCGGTATTAGCGATTCGTAATATCGGCGCGATATATCGA

Therefore, grep may miss some words that span multiple lines.

Fortunately, there is a useful tool called compseq that be used to examine the k-mer composition of a FASTA file. It can be run like this:

compseq file.fasta

#or

compseq -reverse file.fasta  #also counts occurrences on the reverse complement of the sequence

Piping commands

We can also chain together multiple commands like this using the | (pipe) operator.

grep "word" file.txt | wc -l  # will count the number of lines containing the word "word"

# or alternatively

cat file.txt | grep "word" | wc -l  # does the same thing as above

# if we want to count ALL the occurrences of "word" in the file (allowing multiple per line), we can do

grep -o "word" file.txt | wc -l

Copying a file to and from a remote server

To

scp /path/to/file.txt yourUserName@genomics1.private.uwaterloo.ca

From

scp yourUserName@genomics1.private.uwaterloo.ca:/path/to/file.txt /path/to/location/

Remember, your current path can be found using pwd. A useful command for printing out the path to your file is:

realpath file.txt

Downloading a file off the internet

wget <url>

File compression/uncompression

This is done using programs such as tar, and gzip and gunzip. e.g.,

gzip file.txt # to compress it
gunzip file.txt.gz # to uncompress it

More tips

Use tab to autocomplete

Use tab for autocompletion! This will speed up your command-line work dramatically. More here: tab-autocomplete

Use Ctrl-C to interrupt or end a process

If you need to interrupt a command or process that you have started, press Ctrl-C.

Other tips for becoming a linux power user

Linux Tips


ASSIGNMENT QUESTIONS

PLEASE COMPLETE ASSIGNMENT 1 ON LEARN. This can be found under Quizzes.

You will be asked to answer the following questions.

Hint: remember to use man if you want to explore added functionality of commands. Also, the program compseq may be useful to answer some of these questions.

Download and uncompress this file containing the genome sequence of E. coli H20 https://github.com/doxeylab/learn-genomics-in-linux/raw/master/task1/e-coli-genome.fasta.gz

question Q1 - What is the size of the uncompressed file in megabytes (round to one decimal place)?

question Q2 - What is the header (first) line of the file?

question Q3 - How many characters are in this file (header plus genome)?

question Q4 - What are the last five bases in the genome?

question Q5 - What is the length of the genome (# bases)?

question Q6 - What base (A, C, G, or T) is most common in the file?

question Q7 - What is the GC content of the genome?

question Q8 - What is the most common trinucleotide in the file?

question Q9 - How many times does the word “AATGAGAGG” occur in the genome sequence? Do not use compseq to answer this one.

question Q10 - What is the answer to the above question if you also include matches on the reverse complement of the genome sequence? Again, do not use compseq to answer this one.

Congratulations. You are now finished Task 1.